-
PurposeFluorescent human androgen-receptor splice variant 7, lacking the ligand-binding domain (fused to EGFP)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86856 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech (Takara)
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 6642
-
Modifications to backbonenone
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsSequence-verify the poly-glutamine expansion when preparing new plasmid preps. Depositor recommends screening a handful of colonies. See "Depositor Comments" for more information.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAndrogen receptor (AR)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1932
-
MutationAlternative splice variant 7 (alteration/deletion of the C-terminus)
-
GenBank IDNM_000044.3
-
Entrez GeneAR (a.k.a. AIS, AR8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xma I (not destroyed)
- 3′ cloning site Xba I (not destroyed)
- 5′ sequencing primer EGFP-C (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The poly-glutamine repeat region in this plasmid is known to be unstable and the exact number of repeats may vary. However, repeats of 18-26 glutamines are all considered wildtype. Screen multiple colonies to ensure isolation of a plasmid with a suitable number of repeats.
Prostate. 2013 February 15; 73(3): 267–277. doi:10.1002/pros.22566. The activity of the androgen receptor variant AR-V7 is regulated
by FOXO1 in a PTEN-PI3K-AKT-dependent way.
Cloning is described in the supplemental materials (excerpted below).
Cloning Strategy
The carboxy-terminal part of AR-V7 and AR-V1 were PCR amplified by using the following primers: sense (common for AR-V1 and AR-V7 amplification) 5’-GCGCAAGCTTCTGGGTGTCACTATGGAGC (harboring a Hind III site), antisense for AR-V7 GCTCTAGATCAGGGTCTGGTCATTTTGAGATGC (harboring a XbaI site), antisense for AR-V1 GCTCTAGATTAAGGAAGCCATTCTGAGACTCC (also harboring a XbaI site). CMV-AR-V7 and CMV-AR-V1 were generated by replacing a HindIII-XbaI cDNA fragment encoding the carboxy-terminal portion of wild-type AR (subcloned into a pcDNA3 plasmid) with the AR-V7 or AR-V1 fragments generated by PCR. GFP-AR-V7 and GFP-AR-V1 were generated by replacing an XmaI-XbaI cDNA fragment encoding the carboxy-terminal part of wild-type AR, subcloned in frame to the green fluorescent protein of plasmid pEGFP-c1, with XmaI-XbaI fragments from the pcDNA3 plasmids containing the AR-V7 and AR-V1 variants.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-AR V7 was a gift from Michael Mancini & Marco Marcelli (Addgene plasmid # 86856 ; http://n2t.net/addgene:86856 ; RRID:Addgene_86856) -
For your References section:
High-Content Screening Identifies Src Family Kinases as Potential Regulators of AR-V7 Expression and Androgen-Independent Cell Growth. Szafran AT, Stephan C, Bolt M, Mancini MG, Marcelli M, Mancini MA. Prostate. 2017 Jan;77(1):82-93. doi: 10.1002/pros.23251. Epub 2016 Oct 4. 10.1002/pros.23251 PubMed 27699828