-
PurposeFluorescent marker of lipid droplets (LDs)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87159 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEFIRES-P
- Backbone size w/o insert (bp) 5689
- Total vector size (bp) 6571
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHPos
-
SpeciesR. norvegicus (rat), Synthetic; model peptide
-
Insert Size (bp)153
- Promoter EF-1-alpha
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (not destroyed)
- 3′ cloning site SmaI (destroyed during cloning)
- 5′ sequencing primer pEF-forward tctctccacaggtgtccact
- 3′ sequencing primer pEF-rev acaccggccttattccaagc
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector was generated by Shiqian Li (Elina Ikonen Lab).
HPos model peptide was described by Adam Kassan et al. (J Cell Biol. 2013 Dec 23; 203(6): 985–1001.)
Benefits of using pEFIRES-P vector for stable overexpression in mammalian cells were described by Stephen Hobbs et al. (Biochem Biophys Res Commun. 1998 Nov 18;252(2):368-72.).
pEFIRES-P was a gift from Dr. Olli Ritvos (University of Helsinki).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEFIRES-P-mCherry-HPos was a gift from Elina Ikonen (Addgene plasmid # 87159 ; http://n2t.net/addgene:87159 ; RRID:Addgene_87159) -
For your References section:
Seipin regulates ER-lipid droplet contacts and cargo delivery. Salo VT, Belevich I, Li S, Karhinen L, Vihinen H, Vigouroux C, Magre J, Thiele C, Holtta-Vuori M, Jokitalo E, Ikonen E. EMBO J. 2016 Dec 15;35(24):2699-2716. Epub 2016 Nov 22. 10.15252/embj.201695170 PubMed 27879284