Skip to main content

px330-MRPsg2
(Plasmid #87190)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87190 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC ori vector
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human MRP RNA CRISPR guide #2
  • gRNA/shRNA sequence
    GCAGTGTGTAGCCTAGGATAC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    21
  • Entrez Gene
    RMRP (a.k.a. CHH, NME1, RMRPR, RRP2)
  • Promoter human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer CGTAAGTTATGTAACGGGTACCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px330-MRPsg2 was a gift from Thomas Cech (Addgene plasmid # 87190 ; http://n2t.net/addgene:87190 ; RRID:Addgene_87190)
  • For your References section:

    Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing. Goldfarb KC, Cech TR. Genes Dev. 2017 Jan 1;31(1):59-71. doi: 10.1101/gad.286963.116. Epub 2017 Jan 23. 10.1101/gad.286963.116 PubMed 28115465