Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSHS306 - Bacterial expression plasmid for SpCas9, HNH FRET variant
(Plasmid #87350)


Item Catalog # Description Quantity Price (USD)
Plasmid 87350 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 10000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    S. pyogenes
  • Insert Size (bp)
  • Mutation
  • Promoter T7
  • Tag / Fusion Protein
    • His-MBP (N terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAGACTAATTCGAGCTCG
  • 3′ sequencing primer GAAAGGAAGCTGAGTTGGCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Sternberg et al.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSHS306 - Bacterial expression plasmid for SpCas9, HNH FRET variant was a gift from Jennifer Doudna (Addgene plasmid # 87350 ; ; RRID:Addgene_87350)
  • For your References section:

    Conformational control of DNA target cleavage by CRISPR-Cas9. Sternberg SH, LaFrance B, Kaplan M, Doudna JA. Nature. 2015 Nov 5;527(7576):110-3. doi: 10.1038/nature15544. Epub 2015 Oct 28. 10.1038/nature15544 PubMed 26524520