Skip to main content

pBad-HisB-GdT
(Plasmid #87361)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87361 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBad His B
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 4076
  • Total vector size (bp) 4780
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GdT
  • Alt name
    Green dimer Tomato
  • Species
    Synthetic
  • Insert Size (bp)
    704
  • Promoter AraBad
  • Tag / Fusion Protein
    • His-Tag (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATGGTATGGCTAGCATGACTGGT
  • 3′ sequencing primer ACTCAGGAGAGCGTTCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBad-HisB-GdT was a gift from Robert Campbell (Addgene plasmid # 87361 ; http://n2t.net/addgene:87361 ; RRID:Addgene_87361)
  • For your References section:

    A tandem green-red heterodimeric fluorescent protein with high FRET efficiency. Wiens M, Shen Y, Li X, Salem M, Smisdom N, Zhang W, Brown A, Campbell RE. Chembiochem. 2016 Oct 26. doi: 10.1002/cbic.201600492. 10.1002/cbic.201600492 PubMed 27781394