pCSDest2-NmeCas9-NLS-3XHA-NLS
(Plasmid
#87448)
-
PurposeMammalian expression of wild type Nme Cas9
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCSDest2
- Backbone size w/o insert (bp) 4358
- Total vector size (bp) 7604
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNme Cas9
-
SpeciesNeisseria meningitidis
-
Insert Size (bp)3246
- Promoter CMV
-
Tags
/ Fusion Proteins
- SV40 NLS (C terminal on insert)
- 3XHA (C terminal on insert)
- cMyc-like NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTAGGTGACACTATAGA
- 3′ sequencing primer CAGGAAACAGCTATGACCATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSDest2-NmeCas9-NLS-3XHA-NLS was a gift from Erik Sontheimer (Addgene plasmid # 87448 ; http://n2t.net/addgene:87448 ; RRID:Addgene_87448) -
For your References section:
Naturally Occurring Off-Switches for CRISPR-Cas9. Pawluk A, Amrani N, Zhang Y, Garcia B, Hidalgo-Reyes Y, Lee J, Edraki A, Shah M, Sontheimer EJ, Maxwell KL, Davidson AR. Cell. 2016 Dec 15;167(7):1829-1838.e9. doi: 10.1016/j.cell.2016.11.017. Epub 2016 Dec 8. 10.1016/j.cell.2016.11.017 PubMed 27984730