pCSDest2-NmeCas9-NLS-3XHA-NLS
(Plasmid
#87448)
-
PurposeMammalian expression of wild type Nme Cas9
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87448 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 87448-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 87448-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCSDest2
- Backbone size w/o insert (bp) 4358
- Total vector size (bp) 7604
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNme Cas9
-
SpeciesNeisseria meningitidis
-
Insert Size (bp)3246
- Promoter CMV
-
Tags
/ Fusion Proteins
- SV40 NLS (C terminal on insert)
- 3XHA (C terminal on insert)
- cMyc-like NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTAGGTGACACTATAGA
- 3′ sequencing primer CAGGAAACAGCTATGACCATG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 87448-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 87448-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSDest2-NmeCas9-NLS-3XHA-NLS was a gift from Erik Sontheimer (Addgene plasmid # 87448 ; http://n2t.net/addgene:87448 ; RRID:Addgene_87448) -
For your References section:
Naturally Occurring Off-Switches for CRISPR-Cas9. Pawluk A, Amrani N, Zhang Y, Garcia B, Hidalgo-Reyes Y, Lee J, Edraki A, Shah M, Sontheimer EJ, Maxwell KL, Davidson AR. Cell. 2016 Dec 15;167(7):1829-1838.e9. doi: 10.1016/j.cell.2016.11.017. Epub 2016 Dec 8. 10.1016/j.cell.2016.11.017 PubMed 27984730