Skip to main content

pCA24N-p50-ligase
(Plasmid #87742)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87742 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCA24N
  • Backbone manufacturer
    Kitagawa et al. (PMID:16769691)
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    T4 DNA ligase
  • Entrez Gene
    30 (a.k.a. T4p202, lig)
  • Promoter T5-lac
  • Tags / Fusion Proteins
    • 6xHis (N terminal on backbone)
    • human p50/NF-kB (amino acids 40-366) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer pCA24N.for (GATAACAATTTCACACAGAATTCATTAAAGAG)
  • 3′ sequencing primer pCA24N.rev2 — 5'-CAAATCCAGATGGAGTTCTGAGG-3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Previously, we PCR amplified the lig gene from pRBL (Ren et al., 1997; PMID: 9305776). A DNA fragment encoding amino acids 40-366 of human NF-kB (i.e. p50; GenBank accession number NP_003989) was amplified from plasmid pRES112 (Patrick and Blackburn, 2005 - PMID: 16008567).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For complete cloning information, please see the paper's supplement.
For expression, E. coli DH5a-E cells harbouring each expression vector were grown at 37°C in LB broth containing chloramphenicol (34 µg.ml-1), to OD600 ~ 0.6. IPTG (0.4 mM, final concentration) was added as an inducer, and protein over-expression was at 28°C for 16-18 h.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCA24N-p50-ligase was a gift from Wayne Patrick (Addgene plasmid # 87742 ; http://n2t.net/addgene:87742 ; RRID:Addgene_87742)
  • For your References section:

    Engineered DNA ligases with improved activities in vitro. Wilson RH, Morton SK, Deiderick H, Gerth ML, Paul HA, Gerber I, Patel A, Ellington AD, Hunicke-Smith SP, Patrick WM. Protein Eng Des Sel. 2013 Jul;26(7):471-8. doi: 10.1093/protein/gzt024. Epub 2013 Jun 10. 10.1093/protein/gzt024 PubMed 23754529