-
PurposeExpresses lambda-red system with hyg selection marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACBSR, which is based on pBAD
-
Backbone manufacturerN/A
- Backbone size w/o insert (bp) 6300
- Total vector size (bp) 7300
-
Modifications to backbone1. camR in pACBSR replace with hygR 2. replication origin is p15a ts
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Hygromycin, 200 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMight be possible to grow at 37C, but 30C works fine
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehyg
-
Insert Size (bp)1040
-
MutationNone
- Promoter bla
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BgI II (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer AGATCTCGGGGAAATGTGCGCGGAAC
- 3′ sequencing primer CTCGAGGTATATATGAGTAAACTTGGTCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACBSR-hyg was a gift from Pep Charusanti (Addgene plasmid # 87830 ; http://n2t.net/addgene:87830 ; RRID:Addgene_87830) -
For your References section:
Capsule deletion via a lambda-Red knockout system perturbs biofilm formation and fimbriae expression in Klebsiella pneumoniae MGH 78578. Huang TW, Lam I, Chang HY, Tsai SF, Palsson BO, Charusanti P. BMC Res Notes. 2014 Jan 8;7:13. doi: 10.1186/1756-0500-7-13. 10.1186/1756-0500-7-13 PubMed 24398052