Skip to main content
Addgene

TLCV2-RB1
(Plasmid #87836)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87836 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    TLCV2
  • Total vector size (bp) 14873
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR ; Doxycycline inducible; eGFP reporter
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRB1
  • Alt name
    RB1, RB, RB Transcriptional Corepressor 1
  • gRNA/shRNA sequence
    GCTCTGGGTCCTCCTCAGGA
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_000321
  • Entrez Gene
    RB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer human U6-F GAGGGCCTATTTCCCATGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The sgRNA targeting RB1 (sgRB#1) was previously published - Nicolay BN, et al. Proteomic analysis of pRb loss highlights a signature of decreased mitochondrial oxidative phosphorylation. Genes Dev. 2015;29(17):1875–1889. The oligos corresponding to sgRB#1 were ordered then annealed and ligated into TLCV2.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TLCV2-RB1 was a gift from Adam Karpf (Addgene plasmid # 87836 ; http://n2t.net/addgene:87836 ; RRID:Addgene_87836)
  • For your References section:

    Pan-Cancer Analyses Reveal Genomic Features of FOXM1 Overexpression in Cancer. Barger CJ, Branick C, Chee L, Karpf AR. Cancers (Basel). 2019 Feb 21;11(2). pii: cancers11020251. doi: 10.3390/cancers11020251. 10.3390/cancers11020251 PubMed 30795624