-
PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87836 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTLCV2
- Total vector size (bp) 14873
-
Vector typeMammalian Expression, Lentiviral, CRISPR ; Doxycycline inducible; eGFP reporter
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRB1
-
Alt nameRB1, RB, RB Transcriptional Corepressor 1
-
gRNA/shRNA sequenceGCTCTGGGTCCTCCTCAGGA
-
SpeciesH. sapiens (human)
-
GenBank IDNM_000321
-
Entrez GeneRB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer human U6-F GAGGGCCTATTTCCCATGATT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The sgRNA targeting RB1 (sgRB#1) was previously published - Nicolay BN, et al. Proteomic analysis of pRb loss highlights a signature of decreased mitochondrial oxidative phosphorylation. Genes Dev. 2015;29(17):1875–1889. The oligos corresponding to sgRB#1 were ordered then annealed and ligated into TLCV2.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TLCV2-RB1 was a gift from Adam Karpf (Addgene plasmid # 87836 ; http://n2t.net/addgene:87836 ; RRID:Addgene_87836) -
For your References section:
Pan-Cancer Analyses Reveal Genomic Features of FOXM1 Overexpression in Cancer. Barger CJ, Branick C, Chee L, Karpf AR. Cancers (Basel). 2019 Feb 21;11(2). pii: cancers11020251. doi: 10.3390/cancers11020251. 10.3390/cancers11020251 PubMed 30795624