SIN-CMV-Ca9-WPRE
(Plasmid
#87874)
-
PurposeTransfer plasmid for the production of lentiviral vectors
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneSIN lentiviral transfer vector
- Backbone size w/o insert (bp) 7500
- Total vector size (bp) 13204
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9
-
Alt nameCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4140
-
MutationHuman codon-optimized
- Promoter CMV
-
Tag
/ Fusion Protein
- nls (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TAGGCGTGTACGGTGGGAGGC
- 3′ sequencing primer AGCAGCGTATCCACATAGCGTAAAAGGAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byhCas9 from Addgene plasmid 41815
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SIN-CMV-Ca9-WPRE was a gift from Nicole Déglon (Addgene plasmid # 87874 ; http://n2t.net/addgene:87874 ; RRID:Addgene_87874) -
For your References section:
The Self-Inactivating KamiCas9 System for the Editing of CNS Disease Genes. Merienne N, Vachey G, de Longprez L, Meunier C, Zimmer V, Perriard G, Canales M, Mathias A, Herrgott L, Beltraminelli T, Maulet A, Dequesne T, Pythoud C, Rey M, Pellerin L, Brouillet E, Perrier AL, du Pasquier R, Deglon N. Cell Rep. 2017 Sep 19;20(12):2980-2991. doi: 10.1016/j.celrep.2017.08.075. 10.1016/j.celrep.2017.08.075 PubMed 28930690