Skip to main content

pENTR221-H1-sgGFP1-U6-sgGFP2-7SK-sgGFP3
(Plasmid #87906)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87906 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pENTR221
  • Backbone manufacturer
    Thermofisher
  • Backbone size w/o insert (bp) 2600
  • Total vector size (bp) 3684
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgGFP1, sgGFP2, sgGFP3
  • Insert Size (bp)
    1088
  • Promoter H1, U6, 7SK

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CCCAGTCACGACGTTGTAAAACG
  • 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR221-H1-sgGFP1-U6-sgGFP2-7SK-sgGFP3 was a gift from Nicole Déglon (Addgene plasmid # 87906 ; http://n2t.net/addgene:87906 ; RRID:Addgene_87906)
  • For your References section:

    The Self-Inactivating KamiCas9 System for the Editing of CNS Disease Genes. Merienne N, Vachey G, de Longprez L, Meunier C, Zimmer V, Perriard G, Canales M, Mathias A, Herrgott L, Beltraminelli T, Maulet A, Dequesne T, Pythoud C, Rey M, Pellerin L, Brouillet E, Perrier AL, du Pasquier R, Deglon N. Cell Rep. 2017 Sep 19;20(12):2980-2991. doi: 10.1016/j.celrep.2017.08.075. 10.1016/j.celrep.2017.08.075 PubMed 28930690