Skip to main content
Addgene

AAV-U6-sgRNA-hSyn-mCherry
(Plasmid #87916)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 87916 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX552
  • Backbone manufacturer
    Feng Zhang lab
  • Total vector size (bp) 5291
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • gRNA/shRNA sequence
    SapI cloning site
  • Promoter hSyn

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site BspEI (not destroyed)
  • 5′ sequencing primer ctgcgtatgagtgcaagtgggtt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pAAV-minCMV-mCherry (Addgene#27970)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-U6-sgRNA-hSyn-mCherry was a gift from Alex Hewitt (Addgene plasmid # 87916 ; http://n2t.net/addgene:87916 ; RRID:Addgene_87916)
  • For your References section:

    AAV-Mediated CRISPR/Cas Gene Editing of Retinal Cells In Vivo. Hung SS, Chrysostomou V, Li F, Lim JK, Wang JH, Powell JE, Tu L, Daniszewski M, Lo C, Wong RC, Crowston JG, Pebay A, King AE, Bui BV, Liu GS, Hewitt AW. Invest Ophthalmol Vis Sci. 2016 Jun 1;57(7):3470-6. doi: 10.1167/iovs.16-19316. 10.1167/iovs.16-19316 PubMed 27367513