Skip to main content

pHES875
(Plasmid #89192)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89192 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pNH604
  • Backbone size w/o insert (bp) 6559
  • Total vector size (bp) 7926
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pGAL1-mCherry
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Promoter GAL1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PspOMI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AACTAATCAGCGGTACCGGG
  • 3′ sequencing primer CGCACTCACGTAAACACTTAATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The mCherry insert has a G121D mutation that the depositor has confirmed does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHES875 was a gift from Hana El-Samad (Addgene plasmid # 89192 ; http://n2t.net/addgene:89192 ; RRID:Addgene_89192)
  • For your References section:

    Robust Synthetic Circuits for Two-Dimensional Control of Gene Expression in Yeast. Aranda-Diaz A, Mace K, Zuleta I, Harrigan P, El-Samad H. ACS Synth Biol. 2016 Dec 27. doi: 10.1021/acssynbio.6b00251. 10.1021/acssynbio.6b00251 PubMed 27930885