DNA-CARtcr-IRESpuro
(Plasmid
#89346)
-
Purpose2nd generation lentiviral vector which expresses SNAP tagged TCRbeta subunit upstream of a IRESpuro cassette
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
- Total vector size (bp) 11654
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTCR beta gene (Jurkat allele) fused at the N terminus to the SNAP tag
-
SpeciesH. sapiens (human)
- Promoter SFFV
-
Tag
/ Fusion Protein
- SNAPf tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Mlu1 (not destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer SFFV for (GCTTCCCGAGCTCTATAAAAGAGC)
- 3′ sequencing primer IRES rev, WPRE rev (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DNA-CARtcr-IRESpuro was a gift from Ron Vale (Addgene plasmid # 89346 ; http://n2t.net/addgene:89346 ; RRID:Addgene_89346) -
For your References section:
A DNA-Based T Cell Receptor Reveals a Role for Receptor Clustering in Ligand Discrimination. Taylor MJ, Husain K, Gartner ZJ, Mayor S, Vale RD. Cell. 2017 Mar 23;169(1):108-119.e20. doi: 10.1016/j.cell.2017.03.006. 10.1016/j.cell.2017.03.006 PubMed 28340336