Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Lenti-sgCdkn2a/Cre
(Plasmid #89644)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89644 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLL3.3
  • Backbone size w/o insert (bp) 7741
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targeting Cdkn2a
  • gRNA/shRNA sequence
    GCGCTGCGTCGTGCACCGGG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Cdkn2a (a.k.a. ARF-INK4a, Arf, INK4a-ARF, Ink4a/Arf, MTS1, Pctr1, p16, p16(INK4a), p16INK4a, p19<ARF>, p19ARF)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti-sgCdkn2a/Cre was a gift from Monte Winslow (Addgene plasmid # 89644 ; http://n2t.net/addgene:89644 ; RRID:Addgene_89644)
  • For your References section:

    A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Rogers ZN, McFarland CD, Winters IP, Naranjo S, Chuang CH, Petrov D, Winslow MM. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297. 10.1038/nmeth.4297 PubMed 28530655