Lenti-sgRb1/Cre
              
              
                (Plasmid
                
                #89647)
              
            
            
            
          - 
            PurposeExpresses an Rb1-targeting gRNA and Cre-recombinase
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89647 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLL3.3
- Backbone size w/o insert (bp) 7741
- 
              Vector typeMammalian Expression, Lentiviral, Cre/Lox
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert namegRNA targeting Rb1
- 
                    gRNA/shRNA sequenceTCTTACCAGGATTCCATCCA
- 
                    SpeciesM. musculus (mouse)
- 
                        Entrez GeneRb1 (a.k.a. Rb, Rb-1, p110-RB1, pRb, pp105)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Annotated sequence at https://benchling.com/s/seq-IrZ68L5C7kLgGCT2s7QQ
To view Winslow Lab vector sequences on Benchling, please visit https://benchling.com/winslowlab/f_/rgXCLH0mq9-winslow-lab-public-vectors-and-sequences/?sort=name
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: Lenti-sgRb1/Cre was a gift from Monte Winslow (Addgene plasmid # 89647 ; http://n2t.net/addgene:89647 ; RRID:Addgene_89647)
- 
                For your References section: A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Rogers ZN, McFarland CD, Winters IP, Naranjo S, Chuang CH, Petrov D, Winslow MM. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297. 10.1038/nmeth.4297 PubMed 28530655
