Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #89772)


Item Catalog # Description Quantity Price (USD)
Plasmid 89772 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Agilent Technologies
  • Backbone size w/o insert (bp) 6100
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    mouse Wnt5a
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Wnt5a (a.k.a. 8030457G12Rik, Wnt-5a)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ATTCTGAGTCCAAGCTAGGC (beta-globin)
  • 3′ sequencing primer TAGAAGGACACCTAGTCAGA (hGH polyA)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-IRES-hrGFP-mWnt5a was a gift from Ken-Ichi Takemaru (Addgene plasmid # 89772 ; ; RRID:Addgene_89772)
  • For your References section:

    Abrogation of beta-catenin signaling in oligodendrocyte precursor cells reduces glial scarring and promotes axon regeneration after CNS injury. Rodriguez JP, Coulter M, Miotke J, Meyer RL, Takemaru K, Levine JM. J Neurosci. 2014 Jul 30;34(31):10285-97. doi: 10.1523/JNEUROSCI.4915-13.2014. 10.1523/JNEUROSCI.4915-13.2014 PubMed 25080590