Skip to main content
Addgene

pCMV sMTase (eGFP)
(Plasmid #89930)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89930 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 4156
  • Total vector size (bp) 10312
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB 10-beta or ER2267
  • Growth instructions
    Requires strain that is tolerant of CpG methylation
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-MC-IRES-MN
  • Alt name
    NLS-Flag-dCas9-lfl-M.SssI[273-386]-NLS - IRES - NLS-HA-M.SssI[2-272]
  • Insert Size (bp)
    6156
  • Mutation
    deactivated Cas9
  • Promoter CMV
  • Tags / Fusion Proteins
    • Flag (N terminal on insert)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGTGTACGGTGGGAGG
  • 3′ sequencing primer gcttgccaaacctacaggtgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV sMTase (eGFP) was a gift from Carl Novina (Addgene plasmid # 89930 ; http://n2t.net/addgene:89930 ; RRID:Addgene_89930)
  • For your References section:

    Targeted DNA methylation in human cells using engineered dCas9-methyltransferases. Xiong T, Meister GE, Workman RE, Kato NC, Spellberg MJ, Turker F, Timp W, Ostermeier M, Novina CD. Sci Rep. 2017 Jul 27;7(1):6732. doi: 10.1038/s41598-017-06757-0. 10.1038/s41598-017-06757-0 [pii] PubMed 28751638