-
PurposeModified from pEM-Cas9HF1 (Addgene ID: 89961) to include constitutive recA56 to block recA-mediated double-strand break repair.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEM-Cas9HF1
- Total vector size (bp) 7859
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCas9HF1
-
SpeciesS. pyogenes
-
MutationN497A/R661A/Q695A/Q926A
- Promoter pTet
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer taagaaggctggctctgcac (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namerecA56
-
SpeciesE. coli
- Promoter proD
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gctcccgctgcttttaaatat (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEM-Cas9HF1-recA56 was a gift from Michael Lynch (Addgene plasmid # 89962 ; http://n2t.net/addgene:89962 ; RRID:Addgene_89962) -
For your References section:
Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. Moreb EA, Hoover B, Yaseen A, Valyasevi N, Roecker Z, Menacho-Melgar R, Lynch MD. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174. 10.1021/acssynbio.7b00174 PubMed 28915012