pBAD-RDSmCherry1
(Plasmid
#89987)
-
PurposeRed-Shifted variants of red fluorescent protein mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89987 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD His B
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRDSmCherry1
-
Alt nameRed-shifted mCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
-
GenBank IDKX638425.1
-
Tag
/ Fusion Protein
- 6xHis-T7-Xpress (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-RDSmCherry1 was a gift from Robert Campbell (Addgene plasmid # 89987 ; http://n2t.net/addgene:89987 ; RRID:Addgene_89987) -
For your References section:
Engineering of mCherry variants with long Stokes shift, red-shifted fluorescence, and low cytotoxicity. Shen Y, Chen Y, Wu J, Shaner NC, Campbell RE. PLoS One. 2017 Feb 27;12(2):e0171257. doi: 10.1371/journal.pone.0171257. eCollection 2017. PONE-D-16-30422 [pii] PubMed 28241009