This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Addgene will be closed November 22nd & 23rd for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 19th - 23rd. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #89987)


Item Catalog # Description Quantity Price (USD)
Plasmid 89987 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Red-shifted mCherry
  • Species
  • Insert Size (bp)
  • GenBank ID
  • Tag / Fusion Protein
    • 6xHis-T7-Xpress (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-RDSmCherry1 was a gift from Robert Campbell (Addgene plasmid # 89987)
  • For your References section:

    Engineering of mCherry variants with long Stokes shift, red-shifted fluorescence, and low cytotoxicity. Shen Y, Chen Y, Wu J, Shaner NC, Campbell RE. PLoS One. 2017 Feb 27;12(2):e0171257. doi: 10.1371/journal.pone.0171257. eCollection 2017. PONE-D-16-30422 [pii] PubMed 28241009