Skip to main content

pUC19-SOX2-T2A-2xNLS-tdTomato-F2A-Puro
(Plasmid #89991)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89991 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2657
  • Total vector size (bp) 6324
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SOX2-T2A-2xNLS-TdTomato-F2A-Puro
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3667
  • Entrez Gene
    SOX2 (a.k.a. ANOP3, MCOPS3)
  • Promoter none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer M13-fwd tgtaaaacgacggccagt
  • 3′ sequencing primer M13-rv caggaaacagctatgaccatg
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    TdTomato sequence was cloned from pCSCMV:tdTomato (a gift from Gerhart Ryffel, Addgene plasmid #30530).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19-SOX2-T2A-2xNLS-tdTomato-F2A-Puro was a gift from Timo Otonkoski (Addgene plasmid # 89991 ; http://n2t.net/addgene:89991 ; RRID:Addgene_89991)
  • For your References section:

    Generation of a SOX2 reporter human induced pluripotent stem cell line using CRISPR/SaCas9. Balboa D, Weltner J, Novik Y, Eurola S, Wartiovaara K, Otonkoski T. Stem Cell Res. 2017 Jul;22:16-19. doi: 10.1016/j.scr.2017.05.005. Epub 2017 May 17. 10.1016/j.scr.2017.05.005 PubMed 28952927