-
PurposeTo convert human skin fibroblasts into induced motor neurons (hiMN) in combination with NGN2, Sox11, FGF2 and two small molecules, forskolin and dorsomorphin.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 90215 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCSC-SP-PW-IRES-GFP
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer agctcgtttagtgaaccgtcagatc
- 3′ sequencing primer gagcaacatagttaagaataccag (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSC-ISL1-T2A-LHX3 was a gift from Chun-Li Zhang (Addgene plasmid # 90215 ; http://n2t.net/addgene:90215 ; RRID:Addgene_90215) -
For your References section:
Direct Lineage Reprogramming Reveals Disease-Specific Phenotypes of Motor Neurons from Human ALS Patients. Liu ML, Zang T, Zhang CL. Cell Rep. 2016 Jan 5;14(1):115-28. doi: 10.1016/j.celrep.2015.12.018. Epub 2015 Dec 24. 10.1016/j.celrep.2015.12.018 PubMed 26725112