Skip to main content

pCSC-ISL1-T2A-LHX3
(Plasmid #90215)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90215 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCSC-SP-PW-IRES-GFP
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ISL1-T2A-LHX3
  • Species
    H. sapiens (human)
  • Entrez Gene
    ISL1 (a.k.a. ISLET1, Isl-1)
  • Entrez Gene
    LHX3 (a.k.a. CPHD3, LIM3, M2-LHX3)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer agctcgtttagtgaaccgtcagatc
  • 3′ sequencing primer gagcaacatagttaagaataccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCSC-ISL1-T2A-LHX3 was a gift from Chun-Li Zhang (Addgene plasmid # 90215 ; http://n2t.net/addgene:90215 ; RRID:Addgene_90215)
  • For your References section:

    Direct Lineage Reprogramming Reveals Disease-Specific Phenotypes of Motor Neurons from Human ALS Patients. Liu ML, Zang T, Zhang CL. Cell Rep. 2016 Jan 5;14(1):115-28. doi: 10.1016/j.celrep.2015.12.018. Epub 2015 Dec 24. 10.1016/j.celrep.2015.12.018 PubMed 26725112