Skip to main content
Addgene

1037 pGL3 FasL promoter
(Plasmid #9028)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 9028 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGL3 promoter
  • Backbone size w/o insert (bp) 5010
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fas ligand promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    100
  • Entrez Gene
    FASLG (a.k.a. ALPS1B, APT1LG1, APTL, CD178, CD95-L, CD95L, FASL, TNFSF6, TNLG1A)
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer RVprimer3
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Oligonucleotides 5'-GCGCGCTAGCGTGACAGAGTGAGACTCTGTCTCTATTTAAATAAATAAGTAAATAAATAAAC-3' and 5'-GGGG AGATCTGCTTTGTATTTCACAATGTTTTCATTTTCATTGTTTGCCCAG TTTATTTATTT-3', containing the forkhead site of the FasL promoter, were phosphorylated, annealed, and ligated to pGL3-promoter restricted with BglII and NheI to give pGL3-promoter-FasL.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1037 pGL3 FasL promoter was a gift from William Sellers (Addgene plasmid # 9028 ; http://n2t.net/addgene:9028 ; RRID:Addgene_9028)
  • For your References section:

    Forkhead transcription factors are critical effectors of cell death and cell cycle arrest downstream of PTEN. Nakamura N, Ramaswamy S, Vazquez F, Signoretti S, Loda M, Sellers WR. Mol Cell Biol. 2000 Dec . 20(23):8969-82. 10.1128/MCB.20.23.8969-8982.2000 PubMed 11073996