pMST694_BB3_pTet-on_mttA_trpC_pcoxA:pyrGtrunc_AMA2.8
(Plasmid
#90292)
-
PurposeBB3 for mttA integration with homologous flanks at pyrG locus, hygromycin resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 90292 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMST635_BB3_L_AC_hyg_KanOri_pyrG5
- Backbone size w/o insert (bp) 5351
- Total vector size (bp) 14181
-
Vector typeBacterial Expression ; A niger
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemttA
-
SpeciesA. terreus
-
Insert Size (bp)909
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCATGAATCATGCGGCCGCGCGTATCACGAGGCCCTTTCGACTTCACTCGAGTTTACCA
- 3′ sequencing primer GTCTCGTAGGACTCTTGACGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMST694_BB3_pTet-on_mttA_trpC_pcoxA:pyrGtrunc_AMA2.8 was a gift from Michael Sauer (Addgene plasmid # 90292 ; http://n2t.net/addgene:90292 ; RRID:Addgene_90292) -
For your References section:
An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Sarkari P, Marx H, Blumhoff ML, Mattanovich D, Sauer M, Steiger MG. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30643-0. doi: 10.1016/j.biortech.2017.05.004. 10.1016/j.biortech.2017.05.004 PubMed 28533066