Skip to main content

pCZGY546
(Plasmid #90466)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90466 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Gateway Final LR Clone
  • Total vector size (bp) 4847
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Pmec-4-mcherry
  • Species
    C. elegans (nematode), Synthetic
  • GenBank ID
  • Promoter Pmec-4
  • Tag / Fusion Protein
    • mcherry

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CAATTCATCCATGCCACCTGTC
  • 3′ sequencing primer caggaaacagctatgaccatg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Originally made by Dong Yan while he was a member of the Jin lab, a joint lab with the Chisholm lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCZGY546 was a gift from Andrew Chisholm (Addgene plasmid # 90466 ; http://n2t.net/addgene:90466 ; RRID:Addgene_90466)
  • For your References section:

    Highly efficient optogenetic cell ablation in C. elegans using membrane-targeted miniSOG. Xu S, Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. doi: 10.1038/srep21271. 10.1038/srep21271 PubMed 26861262