Skip to main content

BRCA2 A11.2 gRNA
(Plasmid #90550)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 90550 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-sgRNA
  • Backbone manufacturer
    Eric Lander & David Sabatini labs (Addgene plasmid #71409)
  • Backbone size w/o insert (bp) 9151
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    BRCA2 (Guide Designation A11.2)
  • Alt name
    pKMKO series
  • gRNA/shRNA sequence
    CACCGAAACCATCTTATAATCAGC
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
  • 3′ sequencing primer EF1a-R (5'-CACGGCGACTACTGCACTTA-3')
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that gRNA target sequence listed is not strictly the 20nt spacer sequence, but also contains the 5' BsmBI overhang. For more information about knockout human cell lines generated using this plasmid, please see http://cellcycleknockouts.wi.mit.edu/ .

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BRCA2 A11.2 gRNA was a gift from Iain Cheeseman (Addgene plasmid # 90550 ; http://n2t.net/addgene:90550 ; RRID:Addgene_90550)
  • For your References section:

    Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. McKinley KL, Cheeseman IM. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16. 10.1016/j.devcel.2017.01.012 PubMed 28216383