Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMonAID_dCas9-PmCDA_Hyg_ALS
(Plasmid #91692)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 91692 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pZDgRNA_Cas9ver.2 (D10A)_HPT
  • Backbone size w/o insert (bp) 17773
  • Vector type
    Plant Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Species
    Streptococcus pyogenes
  • Mutation
    D10A and H840A for dead Cas9
  • Promoter 2x35S
  • Tag / Fusion Protein
    • PmCDA1 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggaagttcatttcatttggagag
  • 3′ sequencing primer ccatttgcattttgatgtccg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMonAID_dCas9-PmCDA_Hyg_ALS was a gift from Akihiko Kondo (Addgene plasmid # 91692 ; http://n2t.net/addgene:91692 ; RRID:Addgene_91692)
  • For your References section:

    Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion. Shimatani Z, Kashojiya S, Takayama M, Terada R, Arazoe T, Ishii H, Teramura H, Yamamoto T, Komatsu H, Miura K, Ezura H, Nishida K, Ariizumi T, Kondo A. Nat Biotechnol. 2017 Mar 27. doi: 10.1038/nbt.3833. 10.1038/nbt.3833 PubMed 28346401