Skip to main content

pDicAID_nCas9-PmCDA_NptII_Della
(Plasmid #91694)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91694 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZD_OsU3gYSA_HolgerCas9_NPTII
  • Backbone size w/o insert (bp) 17766
  • Modifications to backbone
    Cas9(D10A) mutation was introduced.
  • Vector type
    Plant Expression
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Species
    Streptococcus pyogenes
  • Mutation
    D10A for nickase Cas9
  • Promoter PcUbi
  • Tag / Fusion Protein
    • PmCDA1 (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTGCATAGATCTGGATTACATG
  • 3′ sequencing primer ccatttgcattttgatgtccg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDicAID_nCas9-PmCDA_NptII_Della was a gift from Akihiko Kondo (Addgene plasmid # 91694 ; http://n2t.net/addgene:91694 ; RRID:Addgene_91694)
  • For your References section:

    Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion. Shimatani Z, Kashojiya S, Takayama M, Terada R, Arazoe T, Ishii H, Teramura H, Yamamoto T, Komatsu H, Miura K, Ezura H, Nishida K, Ariizumi T, Kondo A. Nat Biotechnol. 2017 Mar 27. doi: 10.1038/nbt.3833. 10.1038/nbt.3833 PubMed 28346401