pBabe-Tet-off-puro-mCherry-PA(wt)-Vav2
(Plasmid
#91873)
-
PurposePhoto-activatable/light sensitive Vav2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 91873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBABE
- Total vector size (bp) 7200
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameLOV2
-
SpeciesSynthetic
-
Insert Size (bp)447
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer GAGATCAAGCAGAGGCTGAAG
- 3′ sequencing primer AAGTTCTTTTGCCGCCTCATC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameVAV2 DH/PH/ZF
-
Alt nameVAV2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1200
-
Entrez GeneVav2 (a.k.a. 2810040F13Rik, AI847175, Vav-2)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GAGATCAAGCAGAGGCTGAAG
- 3′ sequencing primer AAGTTCTTTTGCCGCCTCATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBabe-Tet-off-puro-mCherry-PA(wt)-Vav2 was a gift from Klaus Hahn (Addgene plasmid # 91873 ; http://n2t.net/addgene:91873 ; RRID:Addgene_91873) -
For your References section:
Engineering extrinsic disorder to control protein activity in living cells. Dagliyan O, Tarnawski M, Chu PH, Shirvanyants D, Schlichting I, Dokholyan NV, Hahn KM. Science. 2016 Dec 16;354(6318):1441-1444. 10.1126/science.aah3404 PubMed 27980211