Skip to main content
Addgene

AOI-WT-Cas9-sg-mouse Ezh2-E10-GFP
(Plasmid #91879)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 91879 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP (PX458)
  • Backbone manufacturer
    Feng Zhang Lab (Addgene #48138)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targeting Ezh2
  • gRNA/shRNA sequence
    GACACCACCTAAACGCCCAG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ezh2 (a.k.a. Enx-1, Enx1h, KMT6, mKIAA4065)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This vector also contains FLAG-tagged SpCas9-2A-EGFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AOI-WT-Cas9-sg-mouse Ezh2-E10-GFP was a gift from Martine Roussel (Addgene plasmid # 91879 ; http://n2t.net/addgene:91879 ; RRID:Addgene_91879)
  • For your References section:

    Inactivation of Ezh2 Upregulates Gfi1 and Drives Aggressive Myc-Driven Group 3 Medulloblastoma. Vo BT, Li C, Morgan MA, Theurillat I, Finkelstein D, Wright S, Hyle J, Smith SM, Fan Y, Wang YD, Wu G, Orr BA, Northcott PA, Shilatifard A, Sherr CJ, Roussel MF. Cell Rep. 2017 Mar 21;18(12):2907-2917. doi: 10.1016/j.celrep.2017.02.073. 10.1016/j.celrep.2017.02.073 PubMed 28329683