-
PurposeDoxycycline inducible expression of human Notch1 ICD
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91897 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLIX_403
-
Backbone manufacturerDavid Root lab
- Backbone size w/o insert (bp) 9396
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNotch1 intracellular domain
-
Alt nameN1ICD
-
Alt nameNotch1-ICD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2360
-
Mutationcodons 1770 to 2555 of human NOTCH1
-
GenBank ID
-
Entrez GeneNOTCH1 (a.k.a. AOS5, AOVD1, TAN1, hN1)
- Promoter TRE promoter, Tet ON
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer LNCX
- 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byInsert DNA obtained by PCR from MIG-NICD plasmid (Dr. Warren Pear)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIX-hN1ICD was a gift from Julien Sage (Addgene plasmid # 91897 ; http://n2t.net/addgene:91897 ; RRID:Addgene_91897)