pAAV-U6-CB2gRNA-CBh-mCherry
(Plasmid #91948)

• Purpose: Expression of gRNA for mouse CB2 cannabinoid receptor and mCherry
• Depositing Lab: Jimok Kim
• Publication: Li et al Neuroscience. 2017 Sep 6. pii: S0306-4522(17)30629-2. doi: 10.1016/j.neuroscience.2017.08.053.

Backbone

• Vector backbone: AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR
• Backbone manufacturer: F. Zhang Lab (Addgene #60229)
• Backbone size w/o insert (bp): 6394
• Total vector size (bp): 5956
• Modifications to backbone: 1. The Cre gene in the backbone plasmid was replaced by the mCherry gene at the restriction sites AgeI and EcoRI. The mCherry DNA was PCR-amplified from the plasmid pAAV-CaMKIIa-hChR2(E123T/T159C)-mCherry (Addgene #35512). 2. The 17-bp scrambled gRNA sequence between the U6 promoter and gRNA scaffolding sequence in the control plasmid was replaced by 19-bp CB2R gRNA sequence, which targets the early part of CB2R coding sequence (26th–44th bp of 1044 bp). gRNA sequence: 5' GTGACCAACGGCTCCAACGG 3'
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 711

Resource Information

• Supplemental Documents:
  • pAAV-U6-CB2gRNA-CBh-mCherry.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry