pET28a-baPrs-hdNadV
(Plasmid
#91950)
-
PurposepET28a-baPrs-hdNadV is a bicistronic vector designed for the simultaneous expression of PRS from Bacillus amyloliquefaciens and NadV from Haemophilus ducreyi
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91950 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-28 a (+)
- Backbone size w/o insert (bp) 5192
- Total vector size (bp) 7706
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namePutative Nicotinamide Phosphoribosyl Transferase
-
Alt namenadV
-
SpeciesHaemophilus ducreyi, strain: ATCC 27722
-
Insert Size (bp)1490
-
GenBank IDNC_005329.1 NC_005329.1
-
Entrez GenenadV (a.k.a. PNAD10009)
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePhosphoribosyl Pyrophosphate Synthetases
-
Alt namePRS
-
SpeciesBacillus amyloliquefaciens strain IAM1523
-
Insert Size (bp)1024
-
Mutationchanged Leucine 135 to Isoleucine
-
GenBank IDHQ636460.1 HQ636460.1
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site NcoI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The prs gene has L135I mutation (ctc to ata) in order to eliminate the alosteric regulation of phosphoribosyl pyrophosphate synthetase (Zakataeva et all., 2011).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-baPrs-hdNadV was a gift from George Cătălin Marinescu (Addgene plasmid # 91950 ; http://n2t.net/addgene:91950 ; RRID:Addgene_91950) -
For your References section:
beta-nicotinamide mononucleotide (NMN) production in Escherichia coli. Marinescu GC, Popescu RG, Stoian G, Dinischiotu A. Sci Rep. 2018 Aug 16;8(1):12278. doi: 10.1038/s41598-018-30792-0. 10.1038/s41598-018-30792-0 PubMed 30115969