Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

lentiMPH v2 (Neo)
(Plasmid #92065)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 92065 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiMPH v2
  • Backbone manufacturer
    Feng Zhang lab
  • Total vector size (bp) 11505
  • Modifications to backbone
    Removed T2A-Hygro by digestion with Bsp1407I and EcoRI. Added T2A-Neo by PCR amplification and ligation into these restriction sites.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MS2-P65-HSF1_2A_Neo
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2526
  • Mutation
    N55K in MS2
  • Entrez Gene
    HSF1 (a.k.a. HSTF1)
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiMPH v2 (Neo) was a gift from Adam Karpf (Addgene plasmid # 92065 ; http://n2t.net/addgene:92065 ; RRID:Addgene_92065)
  • For your References section:

    Co-regulation and function of FOXM1/RHNO1 bidirectional genes in cancer. Barger CJ, Chee L, Albahrani M, Munoz-Trujillo C, Boghean L, Branick C, Odunsi K, Drapkin R, Zou L, Karpf AR. Elife. 2021 Apr 23;10. pii: 55070. doi: 10.7554/eLife.55070. 10.7554/eLife.55070 PubMed 33890574