pLQ-Pxyl/tet-cas9-Pj23119-sgRNA
(Plasmid
#92121)
-
PurposeCRISPR-Cas9 based efficient genome editing in S. aureus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92121 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneunknown
- Total vector size (bp) 4000
-
Modifications to backboneColE1 origin, AmpR, Rep(+), cat resistance
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsHigh copy in S. aureus, low copy in S. aureus. chloramphenicol resistance in S. aureus
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9-Pxyltet-sgRNA-pj23119
-
gRNA/shRNA sequenceatgtgttcgtatgttactgc
-
SpeciesS. pyogenes (cas9)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's QC result finds some discrepancies in the Cas9; the depositor notes the plasmid is still functional
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLQ-Pxyl/tet-cas9-Pj23119-sgRNA was a gift from Sheng Yang (Addgene plasmid # 92121 ; http://n2t.net/addgene:92121 ; RRID:Addgene_92121) -
For your References section:
CRISPR/Cas9-based efficient genome editing in Staphylococcus aureus. Liu Q, Jiang Y, Shao L, Yang P, Sun B, Yang S, Chen D. Acta Biochim Biophys Sin (Shanghai). 2017 Sep 1;49(9):764-770. doi: 10.1093/abbs/gmx074. 10.1093/abbs/gmx074 PubMed 28910979