-
PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse TIGRE acceptor locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92144 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330 Addgene#42230
- Total vector size (bp) 8509
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9-nuclease and sgRNA against mouse TIGRE acceptor locus
-
Alt namepX330-EN1201
-
gRNA/shRNA sequenceACTGCCATAACACCTAACTT
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-EN1201 was a gift from Benoit Bruneau (Addgene plasmid # 92144 ; http://n2t.net/addgene:92144 ; RRID:Addgene_92144) -
For your References section:
Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization. Nora EP, Goloborodko A, Valton AL, Gibcus JH, Uebersohn A, Abdennur N, Dekker J, Mirny LA, Bruneau BG. Cell. 2017 May 18;169(5):930-944.e22. doi: 10.1016/j.cell.2017.05.004. 10.1016/j.cell.2017.05.004 PubMed 28525758