Skip to main content

pX330-EN1201
(Plasmid #92144)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92144 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330 Addgene#42230
  • Total vector size (bp) 8509
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    spCas9-nuclease and sgRNA against mouse TIGRE acceptor locus
  • Alt name
    pX330-EN1201
  • gRNA/shRNA sequence
    ACTGCCATAACACCTAACTT

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-EN1201 was a gift from Benoit Bruneau (Addgene plasmid # 92144 ; http://n2t.net/addgene:92144 ; RRID:Addgene_92144)
  • For your References section:

    Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization. Nora EP, Goloborodko A, Valton AL, Gibcus JH, Uebersohn A, Abdennur N, Dekker J, Mirny LA, Bruneau BG. Cell. 2017 May 18;169(5):930-944.e22. doi: 10.1016/j.cell.2017.05.004. 10.1016/j.cell.2017.05.004 PubMed 28525758