pTEF:ATP
(Plasmid
#92179)
-
PurposeHO-TEF1p-ATeam1.03-KanMX4-HO. Codon optimized for yeast version of the ATeam1.03 ATP FRET sensor (originally from Imamura et al. PNAS, 2009 ), expressed via the TEF1 promoter. HO locus integration.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92179 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneHO-poly-KanMX4-HO
-
Backbone manufacturerVoth et al. (2001) Nucleic Acids Res (PMID: 11410682)
- Backbone size w/o insert (bp) 6062
- Total vector size (bp) 6038
-
Modifications to backboneThe entire backbone was used except for the poly region. Because we used Gibson DNA assembly to construct the plasmid we did not need restriction sites and the poly region.
-
Vector typeYeast Expression ; Integration and expression into yeast.
-
Selectable markersG418 (Geneticin)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATeam1.03 codon optimized for yeast (Saccharomyces cerevisiae)
-
Alt nameATP FRET sensor
-
SpeciesSynthetic
-
Insert Size (bp)1836
-
GenBank ID
- Promoter TEF1p
-
Tag
/ Fusion Protein
- Yeast codon optimized mseCFP (donor) and cp173-mVenus (acceptor) are parts of the ATeam1.03 FRET sensor.
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAGTATTGTGTCATGTTCG
- 3′ sequencing primer GACAGTCACATCATGCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe codon optimized version of the ATeam1.03 FRET sensor was synthesized for us.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The original version of the ATeam1.03 FRET sensor (tested in mammalian cells but not codon optimized for yeast) was published in 2009 by Imamura et al (PMID: 19720993)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTEF:ATP was a gift from Matthias Heinemann (Addgene plasmid # 92179 ; http://n2t.net/addgene:92179 ; RRID:Addgene_92179) -
For your References section:
Autonomous Metabolic Oscillations Robustly Gate the Early and Late Cell Cycle. Papagiannakis A, Niebel B, Wit EC, Heinemann M. Mol Cell. 2017 Jan 19;65(2):285-295. doi: 10.1016/j.molcel.2016.11.018. Epub 2016 Dec 15. 10.1016/j.molcel.2016.11.018 PubMed 27989441