BtuF
(Plasmid
#92209)
-
PurposeExpression of BtuF which is the vitamin B12 binding protein for BtuCD ABC Transporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92209 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET22b(+)
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5406
- Total vector size (bp) 6207
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBtuF
-
Alt nameVitamin B12 Binding Protein
-
Alt namevitamin B12 ABC transporter periplasmic binding protein
-
Insert Size (bp)774
-
MutationBtuF signal sequence removed and uses the PelB signal sequence
-
GenBank ID947574
-
Entrez GenebtuF (a.k.a. b0158, ECK0157, JW0154, yadT)
- Promoter T7 Promoter
-
Tags
/ Fusion Proteins
- 6x His Tag (C terminal on insert)
- PelB Signal Sequence (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer taatacgactcactataggg
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BtuF was a gift from Douglas Rees (Addgene plasmid # 92209 ; http://n2t.net/addgene:92209 ; RRID:Addgene_92209) -
For your References section:
The structure of Escherichia coli BtuF and binding to its cognate ATP binding cassette transporter. Borths EL, Locher KP, Lee AT, Rees DC. Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16642-7. Epub 2002 Dec 10. 10.1073/pnas.262659699 PubMed 12475936