Skip to main content
Addgene

BtuF
(Plasmid #92209)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 92209 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET22b(+)
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5406
  • Total vector size (bp) 6207
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BtuF
  • Alt name
    Vitamin B12 Binding Protein
  • Alt name
    vitamin B12 ABC transporter periplasmic binding protein
  • Insert Size (bp)
    774
  • Mutation
    BtuF signal sequence removed and uses the PelB signal sequence
  • GenBank ID
    947574
  • Entrez Gene
    btuF (a.k.a. b0158, ECK0157, JW0154, yadT)
  • Promoter T7 Promoter
  • Tags / Fusion Proteins
    • 6x His Tag (C terminal on insert)
    • PelB Signal Sequence (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BtuF was a gift from Douglas Rees (Addgene plasmid # 92209 ; http://n2t.net/addgene:92209 ; RRID:Addgene_92209)
  • For your References section:

    The structure of Escherichia coli BtuF and binding to its cognate ATP binding cassette transporter. Borths EL, Locher KP, Lee AT, Rees DC. Proc Natl Acad Sci U S A. 2002 Dec 24;99(26):16642-7. Epub 2002 Dec 10. 10.1073/pnas.262659699 PubMed 12475936