pLenti_dCas9-2xAM_hIRF-1
(Plasmid
#92221)
-
PurposeLentiviral plasmid expressing dCas9-2xAM and gRNA for human IRF-1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92221 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCSII-U6-gRNA-CBh-3xFLAG-PA-dCas9-P2A-Puro
-
Backbone manufacturerYoichi Sekita
- Backbone size w/o insert (bp) 9921
- Total vector size (bp) 14156
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameSp-dCas9-2xAM tag
-
SpeciesSynthetic; S. pyogenes
-
Insert Size (bp)4233
-
Mutationhuman codon-optimized, D10A + H840A
- Promoter CBh
-
Tag
/ Fusion Protein
- 2xAM tag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Age I (not destroyed)
- 3′ cloning site BamH I (not destroyed)
- 5′ sequencing primer TGGCAGTATTCATCCACAATTT
- 3′ sequencing primer CCACATAGCGTAAAAGGAGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegRNA targeting human IRF-1 promoter
-
SpeciesSynthetic
-
Insert Size (bp)20
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Bbs I (destroyed during cloning)
- 3′ cloning site Bbs I (destroyed during cloning)
- 5′ sequencing primer gagggcctatttcccatgat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_dCas9-2xAM_hIRF-1 was a gift from Hodaka Fujii (Addgene plasmid # 92221 ; http://n2t.net/addgene:92221 ; RRID:Addgene_92221) -
For your References section:
enChIP systems using different CRISPR orthologues and epitope tags. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-3262-4. 10.1186/s13104-018-3262-4 PubMed 29482606