pBEST-p70a-UTR3-deGFP-6xHis-T500
(Plasmid
#92224)
-
PurposeExpression of deGFP using the p70a promoter and UTR3
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 92224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBEST
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2530
- Total vector size (bp) 3232
-
Vector typeBacterial Expression, Synthetic Biology ; Cell Free Protein Synthesis (CFPS)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedeGFP
-
Alt nameeGFP-Del6-229
-
SpeciesSynthetic
-
Insert Size (bp)702
- Promoter p70a
-
Tag
/ Fusion Protein
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GTGAAGACTATCGCACCATCAG
- 3′ sequencing primer GATAAAGAAGACAGTCATAAGTGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byVincent Noireaux
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Additional reference:
Shin, J., and Noireaux, V. (2010) Efficient cell-free expression with the endogenous E. Coli RNA polymerase and sigma factor 70. J. Biol. Eng. 4, 8.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBEST-p70a-UTR3-deGFP-6xHis-T500 was a gift from Lital Alfonta (Addgene plasmid # 92224 ; http://n2t.net/addgene:92224 ; RRID:Addgene_92224) -
For your References section:
Tuning of Recombinant Protein Expression in Escherichia coli by Manipulating Transcription, Translation Initiation Rates, and Incorporation of Noncanonical Amino Acids. Schlesinger O, Chemla Y, Heltberg M, Ozer E, Marshall R, Noireaux V, Jensen MH, Alfonta L. ACS Synth Biol. 2017 Mar 9. doi: 10.1021/acssynbio.7b00019. 10.1021/acssynbio.7b00019 PubMed 28230975