PhOTO-C (pMTB:cyto-Dendra2-2A-H2B-Cerulean)
(Plasmid #92402)

• Purpose: Constitutive expression of cytosolic green-to-red photoconvertible Dendra2 and the nuclear blue fluorescent protein Cerulean.
• Depositing Lab: Periklis Pantazis
• Publication: Kalyviotis et al (2020) Behavioral and Neural Genetics of Zebrafish, 309–322.

Backbone

• Vector backbone: pMTB
• Backbone size w/o insert (bp): 6103
• Total vector size (bp): 8241
• Vector type: Zebrafish Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Dendra2
• Species: Synthetic
• Insert Size (bp): 717
• GenBank ID: GU734658.1
• Promoter: bactin2
• Tag / Fusion Protein:
  • No tag, cytosolic expression

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: SP6- atttaggtgacactatagaagag
• 3′ sequencing primer: ccttagtcaccgccttcttg

Gene/Insert 2

• Gene/Insert name: Cerulean
• Species: Synthetic
• Insert Size (bp): 717
• GenBank ID: KP666136.1
• Promoter: bactin2
• Tag / Fusion Protein:
  • H2B tag (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: caggaGAGGGCAGAGGAA
• 3′ sequencing primer: CCGCTGAGCAATAACTAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry