PhOTO-C (pMTB:cyto-Dendra2-2A-H2B-Cerulean)
(Plasmid
#92402)
-
PurposeConstitutive expression of cytosolic green-to-red photoconvertible Dendra2 and the nuclear blue fluorescent protein Cerulean.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92402 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMTB
- Backbone size w/o insert (bp) 6103
- Total vector size (bp) 8241
-
Vector typeZebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameDendra2
-
SpeciesSynthetic
-
Insert Size (bp)717
-
GenBank IDGU734658.1
- Promoter bactin2
-
Tag
/ Fusion Protein
- No tag, cytosolic expression
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer SP6- atttaggtgacactatagaagag
- 3′ sequencing primer ccttagtcaccgccttcttg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCerulean
-
SpeciesSynthetic
-
Insert Size (bp)717
-
GenBank IDKP666136.1
- Promoter bactin2
-
Tag
/ Fusion Protein
- H2B tag (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer caggaGAGGGCAGAGGAA
- 3′ sequencing primer CCGCTGAGCAATAACTAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PhOTO-C (pMTB:cyto-Dendra2-2A-H2B-Cerulean) was a gift from Periklis Pantazis (Addgene plasmid # 92402 ; http://n2t.net/addgene:92402 ; RRID:Addgene_92402)