-
PurposeExpresses GFP-CHMP7 in mammalian cells under a crippled promoter
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 97006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCHMP7
-
SpeciesH. sapiens (human)
-
Entrez GeneCHMP7
- Promoter CMV delta 5
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMGF182 was a gift from Adam Frost & Wesley Sundquist (Addgene plasmid # 97006 ; http://n2t.net/addgene:97006 ; RRID:Addgene_97006) -
For your References section:
LEM2 recruits CHMP7 for ESCRT-mediated nuclear envelope closure in fission yeast and human cells. Gu M, LaJoie D, Chen OS, von Appen A, Ladinsky MS, Redd MJ, Nikolova L, Bjorkman PJ, Sundquist WI, Ullman KS, Frost A. Proc Natl Acad Sci U S A. 2017 Mar 14;114(11):E2166-E2175. doi: 10.1073/pnas.1613916114. Epub 2017 Feb 27. 10.1073/pnas.1613916114 PubMed 28242692