Skip to main content

px330_Rosa_sgRNA
(Plasmid #97007)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97007 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 8489
  • Total vector size (bp) 8509
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rosa26 sgRNA
  • gRNA/shRNA sequence
    ACTGGAGTTGCAGATCACGA
  • Species
    M. musculus (mouse)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GTTTCGCCACCTCTGACTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains a Cas9 gene and a Rosa26-specific sgRNA for CRISPR/Cas9 mediated targeting of large cassettes into the mouse Rosa26 locus.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px330_Rosa_sgRNA was a gift from Russell Ray (Addgene plasmid # 97007 ; http://n2t.net/addgene:97007 ; RRID:Addgene_97007)
  • For your References section:

    A CRISPR toolbox for generating intersectional genetic mouse models for functional, molecular, and anatomical circuit mapping. Lusk SJ, McKinney A, Hunt PJ, Fahey PG, Patel J, Chang A, Sun JJ, Martinez VK, Zhu PJ, Egbert JR, Allen G, Jiang X, Arenkiel BR, Tolias AS, Costa-Mattioli M, Ray RS. BMC Biol. 2022 Jan 28;20(1):28. doi: 10.1186/s12915-022-01227-0. 10.1186/s12915-022-01227-0 PubMed 35086530