-
PurposeExpresses Cas9 and Rosa26 locus specific sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 97007 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 8489
- Total vector size (bp) 8509
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRosa26 sgRNA
-
gRNA/shRNA sequenceACTGGAGTTGCAGATCACGA
-
SpeciesM. musculus (mouse)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GTTTCGCCACCTCTGACTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid contains a Cas9 gene and a Rosa26-specific sgRNA for CRISPR/Cas9 mediated targeting of large cassettes into the mouse Rosa26 locus.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px330_Rosa_sgRNA was a gift from Russell Ray (Addgene plasmid # 97007 ; http://n2t.net/addgene:97007 ; RRID:Addgene_97007) -
For your References section:
A CRISPR toolbox for generating intersectional genetic mouse models for functional, molecular, and anatomical circuit mapping. Lusk SJ, McKinney A, Hunt PJ, Fahey PG, Patel J, Chang A, Sun JJ, Martinez VK, Zhu PJ, Egbert JR, Allen G, Jiang X, Arenkiel BR, Tolias AS, Costa-Mattioli M, Ray RS. BMC Biol. 2022 Jan 28;20(1):28. doi: 10.1186/s12915-022-01227-0. 10.1186/s12915-022-01227-0 PubMed 35086530