Skip to main content

371-GFP
(Plasmid #97030)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 97030 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET
  • Backbone size (bp) 5530
  • Vector type
    Bacterial Expression
  • Promoter T7
  • Tags / Fusion Proteins
    • His6 tag (N terminal on backbone)
    • GFP fusion (N terminal on backbone)
    • TEV cleavage site (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GFP 3' F (5' cagctcgccgaccacta 3')
  • 3′ sequencing primer T7 Reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is an empty vector to be used with a LIC cloning protocol.

It has a TEV cleavable His6-msfGFP fusion tag on the N-terminus.

To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/.

In the 371-Series plasmids, upstream of each ribosome binding site is a Csy4 target sequence that allows the polycistronic mRNA to be cleaved upstream of each message when your plasmid is co-expressed with the Csy4 protein. By cleaving the message we hope to avoid detrimental mRNA structures that may result from having a long polycistronic message.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    371-GFP was a gift from Chris Jeans (Addgene plasmid # 97030 ; http://n2t.net/addgene:97030 ; RRID:Addgene_97030)