pX330-GFP-SFPQ
(Plasmid
#97084)
-
PurposeEncodes an sgRNA that creates a DSB at the promoter of human SFPQ gene.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 97084 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerFeng Zhang (Addgene #42230)
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA GFP-SFPQ
-
gRNA/shRNA sequenceCACCGCTTGACCACAGACATGTCTC
-
SpeciesH. sapiens (human)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer CATATGCTTACCGTAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-GFP-SFPQ was a gift from Archa Fox (Addgene plasmid # 97084 ; http://n2t.net/addgene:97084 ; RRID:Addgene_97084) -
For your References section:
Functional dissection of NEAT1 using genome editing reveals substantial localisation of the NEAT1_1 isoform outside paraspeckles. Li R, Harvey AR, Hodgetts SI, Fox AH. RNA. 2017 Mar 21. pii: rna.059477.116. doi: 10.1261/rna.059477.116. 10.1261/rna.059477.116 PubMed 28325845