pLK88 - Edit-directing plasmid base
(Plasmid
#98814)
-
PurposeEdit-directing plasmid base
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRS426
- Total vector size (bp) 6274
-
Modifications to backbonegRNA
-
Vector typeYeast Expression, CRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCAN1.y gRNA
-
gRNA/shRNA sequenceGATACGTTCTCTATGGAGGA
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derived from p426-SNR52p-gRNA.CAN1.Y-SUP4t, provided by George Church. Contains modifications to the gRNA promoter and structural region that incorporate a BstEII and SphI site for cloning purposes.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLK88 - Edit-directing plasmid base was a gift from Leonid Kruglyak (Addgene plasmid # 98814 ; http://n2t.net/addgene:98814 ; RRID:Addgene_98814)