pKL001
(Plasmid
#98917)
-
PurposeConstitutively expresses the CaPR construct, the voltage indicator PROPS tethered to the calcium sensor GCaMP6f, under the Sigma 70 promoter in E. coli.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98917 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneBB118
-
Backbone manufacturerBio Bricks - iGem parts combined by Ben Dodd
- Backbone size w/o insert (bp) 2384
- Total vector size (bp) 4487
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsColE1 origin; Depositor recommends BW25113 for expression
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCaPR
-
Alt namePROPS fused to GCaMP6f
-
SpeciesSynthetic
-
Insert Size (bp)2103
- Promoter BBa_J23118 - Strong Constitutive
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKL001 was a gift from Joel Kralj (Addgene plasmid # 98917 ; http://n2t.net/addgene:98917 ; RRID:Addgene_98917) -
For your References section:
Voltage-gated calcium flux mediates Escherichia coli mechanosensation. Bruni GN, Weekley RA, Dodd BJT, Kralj JM. Proc Natl Acad Sci U S A. 2017 Aug 29;114(35):9445-9450. doi: 10.1073/pnas.1703084114. Epub 2017 Aug 14. 10.1073/pnas.1703084114 PubMed 28808010