pCW57.1-Tet-UPF1S124A/N138A/T139A (pRKB268)
(Plasmid
#99144)
-
PurposeInducible lentiviral construct to express FLAG-tagged UPF1S124A/N138A/T139A
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 99144 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerAddgene plasmid #41393
- Backbone size w/o insert (bp) 7600
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUPF1
-
Alt nameUPF1, RNA helicase and ATPase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3400
-
MutationFirst 127 codons are optimized to reduce GC content; S124A/N138A/T139A
-
Entrez GeneUPF1 (a.k.a. HUPF1, NORF1, RENT1, UTF, pNORF1, smg-2)
- Promoter pTight
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GTCAGATCGCCTGGAGAATT
- 3′ sequencing primer CTAGTGAGACGTGCGGCTTC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The lentiviral pCW57-FLAG-UPF1wt plasmid was used as a template to introduce the S124A/N138A/ T139A mutations with PCR primers containing mismatched nucleotides that altered the original codons to GCT (Alanine).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1-Tet-UPF1S124A/N138A/T139A (pRKB268) was a gift from Robert Bradley (Addgene plasmid # 99144 ; http://n2t.net/addgene:99144 ; RRID:Addgene_99144) -
For your References section:
The RNA Surveillance Factor UPF1 Represses Myogenesis via Its E3 Ubiquitin Ligase Activity. Feng Q, Jagannathan S, Bradley RK. Mol Cell. 2017 Jul 20;67(2):239-251.e6. doi: 10.1016/j.molcel.2017.05.034. Epub 2017 Jun 29. 10.1016/j.molcel.2017.05.034 PubMed 28669802